curvetl curvetr
Contact Us image
header
curvebl curvebr
curvetl curvetr
Member login
Side Menu

Recommended Antimicrobial Resistance Target G
Microarray Probes

headergif

Target Gene Finder - Recommended Antimicrobial Resistance Target Genes

headergif

ResistanceTargetNameSequence nt (5'-->3')Tm(°C) Amplicon size (pb)References
RNA MethylasesArmAArmAFWCCG AAA TGA CAG TTC CTA TC55.3846Jing-Jou Yan et al, J Antimicrob Chemother 2004. 54:1007-1012 PMID: 15486082
RNA MethylasesArmAArmARVGAA AAT GAG TGC CTT GGA GG57.3846Jing-Jou Yan et al, J Antimicrob Chemother 2004. 54:1007-1012 PMID: 15486082
RNA MethylasesRmtBrmtBFWATG AAC ATC AAC GAT GCC CT55.3769Jing-Jou Yan et al, J Antimicrob Chemother 2004. 54:1007-1012 PMID: 15486082
RNA MethylasesRmtBrmtBRVCCT TCT GAT TGG CTT ATC CA55.3769Jing-Jou Yan et al, J Antimicrob Chemother 2004. 54:1007-1012 PMID: 15486082
RNA MethylasesRmtArmtAFWCTA GCG TCC ATC CTT TCC TC59.4635Keiko Yokoyama et al, Lancet 2003 362:1888-1893 PMID: 14667745
RNA MethylasesRmtArmtARVTTT GCT TCC ATG CCC TTG CC59.4635Keiko Yokoyama et al, Lancet 2003 362:1888-1893 PMID: 14667745
RNA MethylasesRmtCRmtCFCGT ACG GAG TGG GAA AAA GA60.1371unpublished
RNA MethylasesRmtCRmtCRTCC TGC CGA TCG AGT AGA GT59.97371unpublished
RNA MethylasesRmtDRmtDFAAA CTG CTC GCT TCG AAA AA60.13503unpublished
RNA MethylasesRmtDRmtDRGGC AGC ACC TTA AAC AGC AG60.96503unpublished
RNA MethylasesnmpAnpmA-FWGGA GGG CTA TCT AAT GTG GT52371Zhou Y, et al. 2010. Eur J Clin Microboil Infect Dis. PMID: 20614151
RNA MethylasesnmpAnpmA-RVGCC CAA AGA GAA TTA AAC TG48371Zhou Y, et al. 2010. Eur J Clin Microboil Infect Dis. PMID: 20614151
AmpC EnterobacteriaceaeCMY-1 / MOXMOXMFGCT GCT CAA GGA GCA CAG GAT61.8520Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeCMY-1 / MOXMOXMRCAC ATT GAC ATA GGT GTG GTG C60.3520Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeCMY-2CITMFTGG CCA GAA CTG ACA GGC AAA59.8462Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeCMY-2CITMRTTT CTC CTG AAC GTG GCT GGC61.8462Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeDHADHAMFAAC TTT CAC AGG TGT GCT GGG T60.3405Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeDHADHAMRCCG TAC GCA TAC TGG CTT TGC61.8405Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeACCACCMFAAC AGC CTC AGC AGC CGG TTA61.8346Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeACCACCMRTTC GCC GCA ATC ATC CCT AGC61.8346Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeACT / MIREBCMFTCG GTA AAG CCG ATG TTG CGG61.8302Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeACT / MIREBCMRCTT CCA CTG CGG CTG CCA GTT63.7302Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeFOXFOXMFAAC ATG GGG TAT CAG GGA GAT60.3190Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
AmpC EnterobacteriaceaeFOXFOXMRCAA AGC GCG TAA CCG GAT TGG61.8190Perez-Perez FJ, Hanson ND. J Clin Microbiol. 2002 Jun;40(6):2153-62. PMID: 12037080
ESBLSHVSHVERRVATC CCG CAG ATA AAT CAC CA53.8300Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLSHVSHVERFWGGA AAC GGA ACT GAA TGA GG53.5300Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLTEMTEMERFWGTGCGGTATTATCCCGTGTT57.3416Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLTEMTEMERRVAACTTTATCCGCCTCCATCC57.3416Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLCTX-MCTXERRVRVTCNCCGCTGCCGGTYTTATC64.3524Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLCTX-MCTXERFWCGYTTTSCNATGTGCAGYAC58.3524Rodriguez-Villalobos et al. J Antimicrob Chemother 2006. 57:771-774 PMID: 16501056
ESBLCTX-M G1CTXG1 FW 1AGT TCA CGC TGA TGG CGA CG63.2676Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G1CTXG1 RV 3AAC CCA GGA AGC AGG CAG TCC61.8676Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G2CTXG2 FW1ATG ATG ACT CAG AGC ATT CGC CG64.4827Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G2CTXG2 RV 1CGG CTT TCC GCC TTC TGC TC65.2827Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G9CTXG9FWGCC GAA AAA CAG GTC AAC GGC59.5472Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G9CTXG9 RV1GAA CCA GCG GCG CAC GAC62.3472Bogaerts et al. J Antimicrob Chemother 2007. 59:459-464 PMID: 17224412
ESBLCTX-M G8/25CTX8/25FCGC TTT GCC ATG TGC AGC ACC63.7307Pitout JDD, et al. Clin Microbiol Infect. 2007 Mar;13(3):291-7. PMID: 17391384
ESBLCTX-M G8/25CTX8/25RGCT CAG TAC GAT CGA GCC58.2307Pitout JDD, et al. Clin Microbiol Infect. 2007 Mar;13(3):291-7. PMID: 17391384
Minor ESBLPERPER FWAGT GTG GGG GCC TGA CGA T65.2726Glupczynski et al. J Antimicrob Chemother 2010. 65:866-871 PMID:20200037
Minor ESBLPERPER RVGCA ACC TGC GCA ATR ATA GCT T 56.1726Glupczynski et al. J Antimicrob Chemother 2010. 65:866-871 PMID:20200037
Minor ESBLVEBVEB FWCGA CTT CCA TTT CCC GAT GC64.96376Naas et al. J Antimicrob Chemother 2006. 58:178-182 PMID:16670107
Minor ESBLVEBVEB RVTGT TGG GGT TGC CCA ATT TT64.44376 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
Minor ESBLGESGESFW600CTG GCA GGG ATC GCT CAC TC63.5599Bogaerts P. et al. Antimicrob Agents Chemother. 2010 Nov;54(11):4872-8. PMID: 20805394
Minor ESBLGESGESRV600TTC CGA TCA GCC ACC TCT CA59.4599Bogaerts P. et al. Antimicrob Agents Chemother. 2010 Nov;54(11):4872-8. PMID: 20805394
Minor ESBLBELBEL1FCGA CAA TGC CGC AGC TAA CC61.4448Bogaerts et al. Antimicrob Agents Chemother. 2007 51:1584-5. PMID: 17261629
Minor ESBLBELBEL1RCAG AAG CAA TTA ATA ACG CCC55.9448Bogaerts et al. Antimicrob Agents Chemother. 2007 51:1584-5. PMID: 17261629
CarbapenemaseIMPIMPPB1FWGGC GTT TAT GTT CAT ACT TCG TT59.5233 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
CarbapenemaseIMPIMPPB1RVTCG AGA ATT AAG CCA CTC TAT TCC60.1233 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
CarbapenemaseVIMVIM1-437FWTGT CCG TGA TGG TGA TGA GT55.8/57.3437 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
CarbapenemaseVIMVIM1-437RVATT CAG CCA GAT CGG CAT C57,2/56,7 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
CarbapenemaseIMPIMPELLF GGA ATA GAG TGG CTT AAY TCT C51.5188Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseIMPIMPELLRCCA AAC YAC TAS GTT ATC T47.2188Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseVIMVIMELLF GAT GGT GTT TGG TCG CAT A52.5390Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseVIMVIMELLR CGA ATG CGC AGC ACC AG57.3390Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseGIMGIMELLFTCG ACA CAC CTT GGT CTG AA55.7477Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseGIMGIMELLR AAC TTC CAA CTT TGC CAT GC54477Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseSPMSPMELLF AAA ATC TGG GTA CGC AAA CG53.4271Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseSPMSPMELLRACA TTA TCC GCT GGA ACA GG54.5271Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseSIMSIMELLFTAC AAG GGA TTC GGC ATC G54.4570Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseSIMSIMELLR TAA TGG CCT GTT CCC ATG TG54.9570Ellington M, Kistler J, Livermore D,Wooodford N. J Antimicrob Chemother. 2007 Feb;59(2):321-2 PMID: 17185300
CarbapenemaseKPCKPCFTCG CCG TCT AGT TCT GCT GTC TTG67.11353Bogaerts et al 2010. J. Antimicrob. Chemother. 65: 361-362 PMID: 20008447
CarbapenemaseKPCKPCR ACA GCT CCG GCA CCG TCA T66.47353Bogaerts et al 2010. J. Antimicrob. Chemother. 65: 361-362 PMID: 20008447
CarbapenemaseNDMNDM-1FWACTTGGCCTTGCTGTCCTT57603Bogaerts et al.Antimicro Agents Chemother. 2011, 55:3036-8 PMID: 21444697
CarbapenemaseNDMNDM-1RVCATTAGCCGCTGCATTGAT54603Bogaerts et al.Antimicro Agents Chemother. 2011, 55:3036-8 PMID: 21444697
OxacillinaseOXA G2OXA2-15FWGAT GGG ACG GCG TTA ACA GG61.4297 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
OxacillinaseOXA G2OXA2/15rvTCC TTG ACC AAG CGC TGA TG59.4297 Bogaerts, et al. J Antimicrob Chemother. 2008 Mar;61(3):749-51. PMID: 18238886
OxacillinaseOXA-18OXA18FWTAC GTT CTC CCC GGC AAA TG59.4582Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
OxacillinaseOXA-18OXA18RVCTT GGC ATC GGA AAG CGA AC59.4582Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
OxacillinaseOXA-20OXA20FWGAT GGG ACG GCG CTA AAA GA59.4386Bogaerts et al. J Clin Microbiol. 2006;44: 4189-92. PMID: 16957031
OxacillinaseOXA-20OXA20RVTAC CCA ACC GAC CCA CCA AC61.4386Bogaerts et al. J Clin Microbiol. 2006;44: 4189-92. PMID: 16957031
OxacillinaseOXA G10OXAG1longFTGA AAA ACA CAA TAC ATA TCA ACT TCG60.52807Bogaerts et al. Pathol Biol (Paris). 2010 Feb;58(1):78-83. PMID: 19892478
OxacillinaseOXA G10OXAG1longRTGG TGA TCG CAT TTT TCT TG59.66807Bogaerts et al. Pathol Biol (Paris). 2010 Feb;58(1):78-83. PMID: 19892478
OxacillinaseOXA-9OXA9FW AACGGCTTGACCCAGTCATGGC62.1253Bogaerts et al 2010. J. Antimicrob. Chemother. 65: 361-362 PMID: 20008447
OxacillinaseOXA-9OXA9RVCCCAGCCCACGAACCAGCC63.9253Bogaerts et al 2010. J. Antimicrob. Chemother. 65: 361-362 PMID: 20008447
CarbapenemaseOXA-198OXA-198FWATGCATAAACACATGAGTAAG50.45789El Garch et al. Antimicrob Agents Chemother submitted
CarbapenemaseOXA-198OXA-198RVTTATTCGATGATCCCCTTT54.55789El Garch et al. Antimicrob Agents Chemother submitted
CarbapenemaseOXA-23OXA 23FW1CCC CGA GTC AGA TTG TTC AAG G 65.18330unpublished
CarbapenemaseOXA-23OXA 23spécRVTAC GTC GCG CAA GTT CCT GA65.2330unpublished
CarbapenemaseOXA-40OXA24FW1TTT CTT CTC AGC AAC ATG AAA AAG C63465unpublished
CarbapenemaseOXA-40OXA24RV1GTG CAA GGT CAT CGG CAA AA64.35465unpublished
CarbapenemaseOXA-58OXA 58 FW1GGG GCT TGT GCT GAG CAT AGT63.8688unpublished
CarbapenemaseOXA-58OXA 58 RV1CCA CTT GCC CAT CTG CCT TT64.6688unpublished
CarbapenemaseOXA-51OXA51gdFATGAACATTAAAGCACTCTTAC52.8825Vahaboglu et al J. Antimicrob. Chemother.2006 58: 537-42 PMID: 16816400
CarbapenemaseOXA-51OXA51gdRCTATAAAATACCTAATTGTTCT49.1825Vahaboglu et al JAC 2006july1
CarbapenemaseOXA-48OXA-48FGGT AGC AAA GGA ATG GCA AG53.8499Glupczynski et al. In preparation
CarbapenemaseOXA-48OXA-48RGCG CTC CGA TAC GTG TAA CT56.8499Glupczynski et al. In preparation
CarbapenemaseOXA-143OXA-143-FTGGCACTTTCAGCAGTTCCT56.7149Higgins PG et al. Int J Antimicrob Agents. 2010 Mar;35(3):305. PMID: 20022220
CarbapenemaseOXA-143OXA-143-RTAATCTTGAGGGGGCCAACC56.8149Higgins PG et al. Int J Antimicrob Agents. 2010 Mar;35(3):305. PMID: 20022220
CarbapenemaseOXA-48OXA-48ATTG GTG GCA TCG ATT ATC GG54.8744Poirel et al. Antimicrob Agents Chemother. 2004 Jan;48(1):15-22. PMID: 14693513
CarbapenemaseOXA-48OXA-48BGAG CAC TTC TTT TGT GAT GGC54.3744Poirel et al. Antimicrob Agents Chemother. 2004 Jan;48(1):15-22. PMID: 14693513
PenicillinaseCARBCarb5F TGG AAA CGG GAA AAC GTT GG65.13579Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
PenicillinaseCARBCarb5RCAC GCG ACC CAT AAC CAC CA67.29579Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
PenicillinaseCARBCarb1-46F GGA TTA CAA TGG CAA TCA GC58.04370Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
PenicillinaseCARBCarb1-46RTGT CGT ATC CCT CAA ATC ACC59.81370Bogaerts et al 2008. J. Antimicrob. Chemother. 61(3): 749-751 PMID: 18238886
QUINOLONEQnrBQnrBm-F GGM ATH GAA ATT CGC CAC TG57264Cattoir V. et al. J Antimicrob Chemother. 2007 Apr;59(4):751-4.; PMID: 17307773
QUINOLONEQnrBQnrBm-RTTT GCY GYY CGC CAG TCG AA60.4264Cattoir V. et al. J Antimicrob Chemother. 2007 Apr;59(4):751-4.; PMID: 17307773
QUINOLONEQnrAQnrAmFAGA GGA TTT CTC ACG CCA GG56.5580Cattoir V. et al. J Antimicrob Chemother. 2007 Aug;60(2):394-7. PMID: 17561500
QUINOLONEQnrAQnrAmR TGC CAG GCA CAG ATC TTG AC57.3580Cattoir V. et al. J Antimicrob Chemother. 2007 Aug;60(2):394-7. PMID: 17561500
QUINOLONEQnrSQnrSmF GCA AGT TCA TTG AAC AGG GT55.3428Cattoir V. et al. J Antimicrob Chemother. 2007 Aug;60(2):394-7. PMID: 17561500
QUINOLONEQnrSQnrSmR TCT AAA CCG TCG AGT TCG GCG 61.8428Cattoir V. et al. J Antimicrob Chemother. 2007 Aug;60(2):394-7. PMID: 17561500
QUINOLONEAAC6'-lb-crAac6IbcrFTTG CGA TGC TCT TAT GAG TGG CTA61482Park et al, Prevalence in the US of aac(6AAC6')-Ib-cr encoding a ciprofloxacin-modifying enzyme, JAC 2006, p3953-3955
QUINOLONEAAC6'-lb-crAac6IbcrRCTC GAA TGC CTG GCG TGT TT59.4482Park et al, Prevalence in the US of aac(6AAC6')-Ib-cr encoding a ciprofloxacin-modifying enzyme, JAC 2006, p3953-3955
More Information Here
7thframeworklogo The TEMPOtest-QC project has received funding from the European Community's Seventh Framework Programme [FP7/2007-2013] under grant agreement no 241742 EUFlag
curvebl curvebr